View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_212 (Length: 225)
Name: NF1715_high_212
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_212 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 43089784 - 43089991
Alignment:
| Q |
1 |
acataaaaagcctagaatttgaatctgactagttcaatttgagcaaaatctgtttttcttagaactgcattagtaaaatcacataattaattaaagaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089784 |
acataaaaagcctagaatttgaatctgactagttcaatttgagcaaaatctgtttttcttagaactgcattagtaaaatcacataattaattaaagaaaa |
43089883 |
T |
|
| Q |
101 |
gtgaatcaaacttaccaagtaacccctaaatgtggtttgaatcttgacagcagcaaatttctggtgtccaccaccaaacatggtgtctctgccgtggctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43089884 |
gtgaatcaaacttaccaagtaacccctaaatgttgtttgaatcttgacagcagcaaatttctggtgtccaccaccaaacatggtgtctctgccgtggctg |
43089983 |
T |
|
| Q |
201 |
gttaatct |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
43089984 |
gttaatct |
43089991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University