View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_214 (Length: 223)
Name: NF1715_high_214
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_214 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 36201737 - 36201529
Alignment:
| Q |
1 |
ttttaagagaagtttgtctaattttctgtagaaattccttagactacgagtttaataattttttagtctttttcgctaatgttatttgatcatatcccat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36201737 |
ttttaagagaagtttgtcgaattttctgtagaaattccttagactacgagtttaataattttgtagtctttttcgctaatgttatttgatcatatcccat |
36201638 |
T |
 |
| Q |
101 |
atcctttgaacaacttccattatgattgagataatagactctgtaacttcttgtgccattatatcgtatggggaaccggtttactgttcttgggctagtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36201637 |
atcctttgaacaacttccattatgatttagataatagactctgtaacttcttgtgccattatatcgtatggggaaccggtttactgttcttgggctagtt |
36201538 |
T |
 |
| Q |
201 |
tgaggaata |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
36201537 |
tgaggaata |
36201529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 36215633 - 36215572
Alignment:
| Q |
13 |
tttgtctaattttctgtagaaattccttagactacgagtttaataattttttagtctttttc |
74 |
Q |
| |
|
|||||| | ||||||||||||||||||| || ||| ||||| ||||||| ||||||||||| |
|
|
| T |
36215633 |
tttgtccatttttctgtagaaattccttggaatacaagttttataatttagtagtctttttc |
36215572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University