View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_216 (Length: 222)
Name: NF1715_high_216
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_216 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 9034534 - 9034340
Alignment:
| Q |
17 |
aaaaacatggaacaattccaagaaccaaacattccaaagcaaattcatagtaaaattcatctgatttagtcgcaacttgcggatatttaatgttttcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
9034534 |
aaaaacatggaacaattccaagaaccaaacattccaaagcaaattgatagtaaaattcatctgatttagtcgcaacttgcggatatttaatgttttgaga |
9034435 |
T |
|
| Q |
117 |
cttgattttagaaacccacttttattgtagaatatgtagtttaaaaaatggtcattggagaattagattatgtttgcttggttttattcatctca |
211 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9034434 |
cttgattttagaaacccacttttatcgtagaatctgtagtttaaaaaatggtcattgggaaattagattatgtttgcttggttttattcatctca |
9034340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 201
Target Start/End: Original strand, 936076 - 936178
Alignment:
| Q |
100 |
tatttaatgttttcaaacttgattttagaaacccacttttattgtagaatatgta-gtttaaaaaatggtcattggagaattagattatgtttgcttggt |
198 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| |||||| |||| || | || | ||||||| |||||||| | |||||| | |||||||||||| |
|
|
| T |
936076 |
tatttaatgttttctgacatgattttagaaacccatttttatcgtagcatctttaccataaaaaaattgtcattggggtattagaatttgtttgcttggt |
936175 |
T |
|
| Q |
199 |
ttt |
201 |
Q |
| |
|
||| |
|
|
| T |
936176 |
ttt |
936178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University