View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_220 (Length: 217)
Name: NF1715_high_220
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_220 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 45862474 - 45862667
Alignment:
| Q |
17 |
aacattcttctataacagctctagattcatcagaaatctctagcttgtagttgaagtcaggtggtggaggtttgactgaaacctttaagggtctgagaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45862474 |
aacattcttctataacagctctagattcatcagaaatctctagcttgtagttgaagtcaggtggtggaggtttgactgaaacctttaagggtctgagaga |
45862573 |
T |
|
| Q |
117 |
tgtttttgagataaaaaatggattggttgtgaaaatggggaaggttggttttatgatgggggaatacatggaatgaatgattaagatgatgatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45862574 |
tgtttttgagataaaaaatggattggttgtgaaaatggggaaggttggttttatgatgggggaatacatggaatgaatgattaaggtgatgatg |
45862667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University