View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_high_223 (Length: 214)
Name: NF1715_high_223
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_high_223 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 13886300 - 13886502
Alignment:
| Q |
1 |
gatagagaacaaaacggtttgattacatatggtcatttgattaatgacactagaacaagtcctattgttcaaaagatggtgaataagaatggtttgtgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13886300 |
gatagagaacaaaacggtttgattacatatggtcatttgattaatgacactagaacaagtcatattgttcaaaagatggtgaataagaatggtttgtgga |
13886399 |
T |
 |
| Q |
101 |
aaaagaagtttgttgagattatgactgcaactaaatcattatagatcagtgtaaattgtttgaaaaataaaat--tattgagataaattccaaagtaaaa |
198 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| || |||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
13886400 |
aacagaagtttgttgagattatgactgcaactaaatcattgtagataagtgtaaattgtctgtaaaataaagttatattgagatgaattccaaagtaaaa |
13886499 |
T |
 |
| Q |
199 |
gat |
201 |
Q |
| |
|
||| |
|
|
| T |
13886500 |
gat |
13886502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University