View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_111 (Length: 322)
Name: NF1715_low_111
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_111 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 305
Target Start/End: Original strand, 32950493 - 32950796
Alignment:
| Q |
11 |
cagagagcagttaaatcaatatctaaataaaagac----------caaaacataaaccacatggattttcttcatcttaagcctccaactgcttttacac |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32950493 |
cagagagcagttaaatcaatatttaaataaaagactataaagggccaaaacataaaccacatggattttcttcatcttaagcctccaactgcttttaaac |
32950592 |
T |
 |
| Q |
101 |
ttaagctgccttagtgatcctgggtggctggctgctttcgaacttcagttatcttagctttctgccttcggtcttcagctttctgcattctgtctttagc |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32950593 |
ttaagctgccttagcgatcctgggtggctggcttctttcgaacttca-ttatcttagctttctgctttcggtcttcagctttctgcattctgtctttagc |
32950691 |
T |
 |
| Q |
201 |
tttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatcttcaagattttgaacttcagcgaaatctatctcttcaccgatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950692 |
tttccgctttctgtctctcagctttagaatttcgatgttagctttcctccttttatcttcaagattttgaacttcagcgaaatctatctcttcaccgatc |
32950791 |
T |
 |
| Q |
301 |
ctcat |
305 |
Q |
| |
|
||||| |
|
|
| T |
32950792 |
ctcat |
32950796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University