View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_117 (Length: 318)
Name: NF1715_low_117
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_117 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 120 - 303
Target Start/End: Complemental strand, 38058059 - 38057876
Alignment:
| Q |
120 |
tagcctgaggctaattgtaaactttgtaactttctatcgggtgtggatcccttgatttaannnnnnncttcaatgaaaaacactttgtattatcttataa |
219 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38058059 |
tagcatgagtctaattgtaaactttgtaactttccatcgggtgtggatcccttgatctaatttttttcttcaatgaaaaacactttgtattatcttataa |
38057960 |
T |
 |
| Q |
220 |
tataaaacaatgaccattaattaaatacccatttcagagaaaatcaaccgatttcatgcacattatttgaatgacagttatctg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||| ||| ||||| |||| |
|
|
| T |
38057959 |
tataaaacaatgaccattaattaaatacccatttcagataaaatcaactgaattcatgcacattatttggatgtcagttgtctg |
38057876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University