View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1715_low_117 (Length: 318)

Name: NF1715_low_117
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1715_low_117
NF1715_low_117
[»] chr8 (1 HSPs)
chr8 (120-303)||(38057876-38058059)


Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 120 - 303
Target Start/End: Complemental strand, 38058059 - 38057876
Alignment:
120 tagcctgaggctaattgtaaactttgtaactttctatcgggtgtggatcccttgatttaannnnnnncttcaatgaaaaacactttgtattatcttataa 219  Q
    |||| |||| |||||||||||||||||||||||| ||||||||||||||||||||| |||       |||||||||||||||||||||||||||||||||    
38058059 tagcatgagtctaattgtaaactttgtaactttccatcgggtgtggatcccttgatctaatttttttcttcaatgaaaaacactttgtattatcttataa 38057960  T
220 tataaaacaatgaccattaattaaatacccatttcagagaaaatcaaccgatttcatgcacattatttgaatgacagttatctg 303  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||| ||| ||||| ||||    
38057959 tataaaacaatgaccattaattaaatacccatttcagataaaatcaactgaattcatgcacattatttggatgtcagttgtctg 38057876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University