View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_120 (Length: 316)
Name: NF1715_low_120
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_120 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 132 - 285
Target Start/End: Complemental strand, 12025467 - 12025314
Alignment:
| Q |
132 |
tttgaaaggttttttcaaatgaaaccctaatcaagagactttcgaaagaacggtggtagcaacagtttcaaatggatgaagataacatcgttgagattca |
231 |
Q |
| |
|
||||| ||||||| ||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12025467 |
tttgataggttttgtcaaacgaaaccctaatcaagagactttgagaagaacggtggtagcaagagtttcaaatggatgaagatgacatcgttgagattca |
12025368 |
T |
 |
| Q |
232 |
tcccttcaaaaagcataaacgtgtatgcatgcatacttctattttcattgcttt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
12025367 |
tcccttcaaaaagcataaacgtgtatgcattcatgcttctattttcattacttt |
12025314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University