View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_122 (Length: 315)
Name: NF1715_low_122
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_122 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 278
Target Start/End: Original strand, 44531626 - 44531888
Alignment:
| Q |
16 |
taatgatggagacttgttccggggagaatattgtaccggttacggcgcaaaacggaggcggcggtgaagagaaaggaagagaggttggtggtgaggaaga |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531626 |
taatgatggagacttgttccggtgagaatattgtaccggttacggcgcaaaacggaggcggccgtgaagagaaaggaagagaggttggtggtgaggaaga |
44531725 |
T |
|
| Q |
116 |
tgataagatgaatatcaatattaacggtggtggaggaaataggtggccccgccaagaaacattggctctcttgaagataagatcagatatggatggtgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531726 |
tgataagatgaatatcaatattaacggtggtggaggaaataggtggccccgccaagaaacattggctctcttgaagataagatcagatatggatggtgtt |
44531825 |
T |
|
| Q |
216 |
tttcgtgattcaagtcttaagggtccactttgggaagaggtttcaaggtatagtacatctatg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44531826 |
tttcgtgattcaagtcttaagggtccactttgggaagaggtttcaaggtatagtacatctatg |
44531888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University