View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_131 (Length: 304)
Name: NF1715_low_131
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_131 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 39747374 - 39747554
Alignment:
| Q |
18 |
aaaaggataagaatttaaaggttttaaatttacattctgatnnnnnnnnnttaatttaacaattaactattaacattctatcattatcatattttatcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39747374 |
aaaaggataagaatttaaaggttttaaatttacattctgataaaaaaaa-ttaatttaacaattaactattaacattctatcattaccatattttatcat |
39747472 |
T |
 |
| Q |
118 |
ctatagttgtatagatgaacaatatcatataccatatgtcaaataaaatttggagaattatt-----gaataactttttgtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39747473 |
ctatagttgtatagatgaacaatatcatataccatatgtcaaataaaatttggagaattattcatgtgaataactttttgtt |
39747554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University