View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_137 (Length: 290)
Name: NF1715_low_137
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_137 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 31 - 273
Target Start/End: Complemental strand, 48412024 - 48411786
Alignment:
| Q |
31 |
attaaatagttagaccatcaagtattcattcataatgatgtctttgaactcttaattttgcttnnnnnnntgacaattgtagtaatacggagagaatgtt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48412024 |
attaaatagttagaccatcaagtattcat----aatgatgtctttgaactcttaattttgcttaaaaaaatgacaattgtagtaatacggagagaatgtt |
48411929 |
T |
|
| Q |
131 |
gttttgtttctttcatgtgtatgaattgtcaaggccctagcttgaacttatttcaatatgtaatcatttgaatttgtggtgcagaaagagcatgcctaaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48411928 |
gttttgtttctttcatgtgtatgaattgtcaaggccctagcttgaacttatttcaatatgtaatcatttgaatttgtggtgcagaaagagcatgcctaaa |
48411829 |
T |
|
| Q |
231 |
tggaaggagcaagtgaagatttgcacaaacacaggattatctg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48411828 |
tggaaggagcaagtgaagatttgcacaaacacaggattatctg |
48411786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University