View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_148 (Length: 274)
Name: NF1715_low_148
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_148 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 26410608 - 26410402
Alignment:
| Q |
19 |
agttacggcggttaaggtggcggtgggagttgtgattattaacgtgtaggattcgtcggtggcgtggtttagttctgtgtttgggtttgttatggttatt |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26410608 |
agttacagcggttaaggtggcggtgggagttgtgattattaacgtgtaggattcgtcggtggcgtggtttagttctgtgtttgggtttgttatggttatt |
26410509 |
T |
|
| Q |
119 |
gttagggtttgaagaggtggtagattgtttgagaggtttgtttttggtgggattaagggatggttgtgttctgttttgatgaggtttgtgtagcgggata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26410508 |
gttagggtttgaagaggtggtagattgtttgagaggtttgtttttggtgggattaagggatggttgtgttctgttttgatgaggtttgtgtagcgagata |
26410409 |
T |
|
| Q |
219 |
tggcggc |
225 |
Q |
| |
|
||||||| |
|
|
| T |
26410408 |
tggcggc |
26410402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University