View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_153 (Length: 263)
Name: NF1715_low_153
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_153 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 33383246 - 33383495
Alignment:
| Q |
1 |
aaagaagtatgaaattttggaagttggtgataaaaaatatgttgcaagtatctacctgactacctcaaatatcaaatcattgaggtagctgttatcactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
33383246 |
aaagaagtatgaaattttggaagttggtgataaaaaatatgttgcaagtatctacctgactacctcaaatatgaaatcattgaggtagctattatcactt |
33383345 |
T |
 |
| Q |
101 |
gaagttctgaagttgctattatcattgnnnnnnnnntgctcagatgacttgtttaaagtagctattatcatagaaaaaattacccttcatagaaatacct |
200 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33383346 |
gaagttctgaagttgctattatcatag-gaaaaaaatgctcagatgactagtttaaagtagctattatcatagaaaaaattacccttcatagaaatacct |
33383444 |
T |
 |
| Q |
201 |
caaaaatattattcgaagacacaaaaccgatgaattttctctaaaaagtat |
251 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33383445 |
caaaaatattattcgaagaaacaaaaccgatgaattttctctaaaaagtat |
33383495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University