View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_167 (Length: 250)
Name: NF1715_low_167
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_167 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 233
Target Start/End: Complemental strand, 51937971 - 51937759
Alignment:
| Q |
17 |
tattattatattcatgatcgatgctatatatgaattgaattaatactaattttgtgtttaatcaataatggatcgatcagtgaatcgttggcgtcgttga |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
51937971 |
tattattatattaatgatcgatgctatatatgaattgaattaatactaattttgtgtttaattaataatggatc----agtgaatcgttggcgtcgttga |
51937876 |
T |
|
| Q |
117 |
caagggagacaggacctaaggtggtgaaaggagacccagccagcaaagggagtagttcacacgtggatcatcaccagcatagtcctcttatttcaacagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51937875 |
caagggagacaggacctaaggtggtgaaaggagacccagccagcaaagggagtagttcacacgtggatcatcaccagcatagtcctcttatttcaacagc |
51937776 |
T |
|
| Q |
217 |
atttgatgttagtgata |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
51937775 |
atttgatgttagtgata |
51937759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University