View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_176 (Length: 243)
Name: NF1715_low_176
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_176 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 17192064 - 17191846
Alignment:
| Q |
1 |
tgattgtacggtcgataaggcgaggttagactttgctcgtgttcttgtttcaacaacttcgttggaggtggttaatttactatctgaggttgtgatagat |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17192064 |
tgattgtacggtcgataaggtgaggttagactttgctcgtgttcttgtttcaacaacttcgttggaggtggttaattcactatctgaggttgtgatagat |
17191965 |
T |
|
| Q |
101 |
ggtcgtgtacactcggttaaattggtggaggagtggggatgcaatttaggcgaggatgcgtttttatcggaggaagaaatggttaaaagtgtggaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
17191964 |
ggtcgtgtacactcggttaaattggtggaggaatggggttgtaatttaggcgaggatgcgtttttatcggaggaagaaatggttccaagtgtggaagtgt |
17191865 |
T |
|
| Q |
201 |
tatctaatcataatgagga |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
17191864 |
tatctaatcataatgagga |
17191846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 178
Target Start/End: Complemental strand, 32220036 - 32219867
Alignment:
| Q |
9 |
cggtcgataaggcgaggttagactttgctcgtgttcttgtttcaacaacttcgttggaggtggttaatt-tactatctgaggttgtgatagatggtcgtg |
107 |
Q |
| |
|
|||| |||| |||||| || || ||||||||||||||| |||| ||||||| |||||||| ||||||| |||| | ||| ||||| || |||||| || |
|
|
| T |
32220036 |
cggtggatagggcgagattggattttgctcgtgttcttatttcgacaacttttttggaggttgttaattatacttt-tgaagttgttattgatggttgta |
32219938 |
T |
|
| Q |
108 |
tacactcggttaaattggtggaggagtggggatgcaatttaggcgaggatgcgtttttatcggaggaagaa |
178 |
Q |
| |
|
| | | | || ||||||||||| |||| || |||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
32219937 |
attatttgttaaagttggtggaggaatgggattgtaatttaggggaggatgcatttttatcggaagaagaa |
32219867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 21309189 - 21309245
Alignment:
| Q |
122 |
ttggtggaggagtggggatgcaatttaggcgaggatgcgtttttatcggaggaagaa |
178 |
Q |
| |
|
||||||||||| ||||| || ||||| || |||||||| ||||||||||| |||||| |
|
|
| T |
21309189 |
ttggtggaggaatgggggtgtaatttgggggaggatgcttttttatcggaagaagaa |
21309245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University