View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_178 (Length: 242)
Name: NF1715_low_178
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_178 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 9300910 - 9300684
Alignment:
| Q |
1 |
atctccttaaatttacaaatcaaaagtaagtagtttgtttcaaagtaataaaccattgacaatattatatatctaataattattttcatctaatctaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9300910 |
atctccttaaatttacaaatcaaaagtaagtagtttgtttcaaagtaataaaccattgacaatattatatatctaataattattttcatctaatctaact |
9300811 |
T |
 |
| Q |
101 |
ctttaatcacttccagctccaaactcataggttttgaaacgatactagcagttgtattggtggaagtcgatggcccaaaaggattgcgtggaacttttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9300810 |
ctttaatcacttccagctccaaactcataggttttgaaacgatactagcagttgtattggtggaagtcgatggcccaaaaggattgcgtggaacttttag |
9300711 |
T |
 |
| Q |
201 |
cttgtctccctctccttgtaacatttg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9300710 |
cttgtctccctctccttgtaacatttg |
9300684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 91 - 228
Target Start/End: Original strand, 9466118 - 9466255
Alignment:
| Q |
91 |
taatctaactctttaatcacttccagctccaaactcataggttttgaaacgatactagcagttgtattggtggaagtcgatggcccaaaaggattgcgtg |
190 |
Q |
| |
|
|||||||| |||| ||| ||||| ||||| ||| | ||| | |||| ||| |||||||||||| ||| || ||||| | |||||||||||||||| | |
|
|
| T |
9466118 |
taatctaattcttgaataacttctagctcgaaatttatacgctttgtaacagtactagcagttgaattagttgaagttgtaggcccaaaaggattgctgg |
9466217 |
T |
 |
| Q |
191 |
gaacttttagcttgtctccctctccttgtaacatttgt |
228 |
Q |
| |
|
| ||||||| ||||||||| || ||||||| ||||||| |
|
|
| T |
9466218 |
ggacttttaacttgtctccatcaccttgtagcatttgt |
9466255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University