View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_182 (Length: 242)
Name: NF1715_low_182
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_182 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 33383065 - 33382839
Alignment:
| Q |
1 |
tctcatccttcaaaacattggcaacctttttgttgttaagaaggacaccatcttgtgttaccatcttttgaagtgattaccttcaaaccgaaatagtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
33383065 |
tctcatccttcaaaacattggcaacctttatgttgtcaagaaggacaccatcttgtgttaccatcttttgaagtgattaccatcaaaccgaagtagtttt |
33382966 |
T |
|
| Q |
101 |
ctgtagtcatgaacatcaaatccagagccaataatttctttggtagacatgatggaaaagaaacaccttgagattgttgtaacttgataaaataaaaatt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33382965 |
ctgtagtcaggaacatcaaatccagagccaataatttctttggtagacatgatggaaaagaaatgccttgagattgttgtaacttgataaaataaaaatt |
33382866 |
T |
|
| Q |
201 |
agaaacattttagctatcgaagagatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33382865 |
agaaacattttagctatcgaagagatt |
33382839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University