View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_193 (Length: 238)
Name: NF1715_low_193
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_193 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 26969670 - 26969889
Alignment:
| Q |
19 |
tgttgttgggtctcttttgccaactacggcttctcttgcattctcgtaggtgtcctgaacagccttcatcactgatccaattacaccgggcttctcttga |
118 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26969670 |
tgttgttgggtcccttttgccaactacagcttctcttgcattctcgtaggtgtcatgaacagccttcatcactgaaccaattacaccgggcttctcttga |
26969769 |
T |
|
| Q |
119 |
tcatgttgttcttttgttacactga-tttcttcaacgtgtcttggttgttttgatgccatttgaagaagaagaattaatgtagctttagtttttgttgtg |
217 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26969770 |
tcatgttgttcttttgtta-actgattttcttcaacgtgtcttggttgttttgatcccatttgaagaagaagaattaatgtagctttagtttttgttgtg |
26969868 |
T |
|
| Q |
218 |
tttttcttttctagtaagata |
238 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
26969869 |
tgtttcttttctagtaagata |
26969889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University