View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_208 (Length: 232)
Name: NF1715_low_208
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_208 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 45704607 - 45704821
Alignment:
| Q |
1 |
agagtaaatcgtattttagggatcaaggttttaaaagaagctgcttgttttttacatcaagtcttagagatcctaggtcattatcatttagagctgctta |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45704607 |
agagtaaatcatattttagggatcaaggttttaaaagaagctgcttgttttttacatcaagtcttagagatcctaggtcattatcatttagagctgctta |
45704706 |
T |
 |
| Q |
101 |
tataagattgttggaatgcgacgatgcacaccaaatgtgtgcatatgttggctcattatttcacatgtttgtgccagacttgaaagagaatgttatcgaa |
200 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45704707 |
tataagattgttggaatgtgacgacgcacaccaaatgtgtgcatatgttggctcattatttcacatgtttgtgccagacttgaaagagaatgtcatcgaa |
45704806 |
T |
 |
| Q |
201 |
gcattgagtaactgt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45704807 |
gcattgagtaactgt |
45704821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University