View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_234 (Length: 211)
Name: NF1715_low_234
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_234 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 27142142 - 27141962
Alignment:
| Q |
17 |
actatcaatgaacataatactttgttttttcttcccaagataattaaggagggnnnnnnnn---ataatttatttgattgatgaccatttgtttt-gttt |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27142142 |
actatcaatgaacataatacttt--tttttcttcccaagataattaaggaggttttttttttttataatttatttgattgatgaccatttgtttttgttt |
27142045 |
T |
|
| Q |
113 |
tagatagagaccataactcagcaatcaacttatttttatagttttagatttggaaaataatctatgaaacacgtcattcatattc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27142044 |
tagatagagaccataactcagcaatcaacttatttt--tagttttagatttggaaaataatctatgaaacacgtccttcatattc |
27141962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University