View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715_low_80 (Length: 361)
Name: NF1715_low_80
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 69 - 170
Target Start/End: Complemental strand, 2492871 - 2492770
Alignment:
| Q |
69 |
actttattggattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaactccagcagggtttatggttcaatattat |
168 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
2492871 |
actttattgaattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaacaacagcaggatttatggttcaatattat |
2492772 |
T |
 |
| Q |
169 |
gt |
170 |
Q |
| |
|
|| |
|
|
| T |
2492771 |
gt |
2492770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 72 - 170
Target Start/End: Complemental strand, 2489587 - 2489489
Alignment:
| Q |
72 |
ttattggattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaactccagcagggtttatggttcaatattatgt |
170 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489587 |
ttattggattctcttgcttcaaatgtggttgatcaccaaggattttaccaaaccactgtaggagaaaactccagcagggtttatggttcaatattatgt |
2489489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 72 - 170
Target Start/End: Complemental strand, 2495998 - 2495900
Alignment:
| Q |
72 |
ttattggattctcttgcttcaaacgtggttgatcaccatggattttaccaaaccattgcaggagaaaactccagcagggtttatggttcaatattatgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||| |||| | | |||| |||||||| ||||||||||| |
|
|
| T |
2495998 |
ttattggattctcttgcttcaaacgtcgttgatagccatggattttaccaaaccattgtaggaaaaaagcctaacaggctttatggtacaatattatgt |
2495900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 187 - 332
Target Start/End: Original strand, 4150046 - 4150191
Alignment:
| Q |
187 |
agagtgatagaattgattttaccttatatcaaatgttatgaaacataaacacaaacatacaaaccggacacgaaaccaacatctatatgcagacaccgat |
286 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||| |||||||||| |||||||||||||||||| ||||| ||| ||||||||| | |||||| || |
|
|
| T |
4150046 |
agagtgttagaattgattttaccttctatcaaatgatatgaaacattgacacaaacatacaaaccgaacacggcacccacatctatacgtagacactgaa |
4150145 |
T |
 |
| Q |
287 |
aacaattaaggaaaattgaagtgattgtatgtaaccacacttatta |
332 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| || ||||| ||||| |
|
|
| T |
4150146 |
aacaattaaagaaaattgatgtgattgtatgaaatcacacctatta |
4150191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University