View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1716-Insertion-1 (Length: 75)
Name: NF1716-Insertion-1
Description: NF1716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1716-Insertion-1 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 44294595 - 44294662
Alignment:
| Q |
8 |
gaagaggcgcgaatgggcaacttggaattggggacaccattgactggtaattgcttctaaacctagta |
75 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44294595 |
gaagaggcacgaatgggcaacttggaattggggacaccattgactggtaattgcttctaaacctagta |
44294662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 50760036 - 50759969
Alignment:
| Q |
8 |
gaagaggcgcgaatgggcaacttggaattggggacaccattgactggtaattgcttctaaacctagta |
75 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50760036 |
gaagaggcacgaatgggcaacttggaattggggacaccattgactggtaattgcttctaaacctagta |
50759969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University