View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1716-Insertion-4 (Length: 320)
Name: NF1716-Insertion-4
Description: NF1716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1716-Insertion-4 |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 9e-27; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 195 - 272
Target Start/End: Complemental strand, 2475828 - 2475751
Alignment:
| Q |
195 |
acaaacaagttttctacttaaaagttataggaaattgtagcaactcaggcagatcgatatctttttatgctttaactt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||| ||||||||| |
|
|
| T |
2475828 |
acaaacaagttttctacttaaaagttataggaaattgtagcaactcagtcggattgatatctttttatactttaactt |
2475751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 7 - 99
Target Start/End: Complemental strand, 2476016 - 2475924
Alignment:
| Q |
7 |
agtgaccaccaggttgttaggaaaccatagaaaaatataactatgtagatcgtatcaaagctctttcataatcaattctttgtttaaactaca |
99 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||| || ||||||||||| ||||||||| | |||||||||| ||||| ||||||||| |
|
|
| T |
2476016 |
agtgaccaccaggttgtcaggaaaacatagaaaaatatagctctgtagatcgtagcaaagctctgtaataatcaattgtttgtctaaactaca |
2475924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 257 - 320
Target Start/End: Original strand, 19589938 - 19590001
Alignment:
| Q |
257 |
ttttatgctttaacttggatagtgtatacttacacttagtcttttcacccttagatattcatag |
320 |
Q |
| |
|
|||||| || ||||||||| ||||||||||| ||| |||||||||||||||| ||| |||||| |
|
|
| T |
19589938 |
ttttatactataacttggacagtgtatacttgcacccagtcttttcacccttaaatactcatag |
19590001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 245 - 303
Target Start/End: Original strand, 20176460 - 20176518
Alignment:
| Q |
245 |
agatcgatatctttttatgctttaacttggatagtgtatacttacacttagtcttttca |
303 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||| ||| ||| |||||||||| |
|
|
| T |
20176460 |
agatcgatatctttttatactataacttggacagtgtatccttgaactcagtcttttca |
20176518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 300
Target Start/End: Original strand, 16259184 - 16259229
Alignment:
| Q |
255 |
ctttttatgctttaacttggatagtgtatacttacacttagtcttt |
300 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
16259184 |
ctttttatactataacttggacagtgtatacttgcacttagtcttt |
16259229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 246 - 320
Target Start/End: Original strand, 15245156 - 15245230
Alignment:
| Q |
246 |
gatcgatatctttttatgctttaacttggatagtgtatacttacacttagtcttttcacccttagatattcatag |
320 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| |||||| ||||| |||||||| |||| ||||| |
|
|
| T |
15245156 |
gatcgatatctttttatgctataacttggaccgtgtatacttgcacttaatctttccacccttaaatatacatag |
15245230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 246 - 300
Target Start/End: Original strand, 26661348 - 26661402
Alignment:
| Q |
246 |
gatcgatatctttttatgctttaacttggatagtgtatacttacacttagtcttt |
300 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||| |||| ||||||| |
|
|
| T |
26661348 |
gatcgatatctttttatactataacttggatagtgtatacttgcactaagtcttt |
26661402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 7 - 95
Target Start/End: Original strand, 15244911 - 15244999
Alignment:
| Q |
7 |
agtgaccaccaggttgttaggaaaccatagaaaaatataactatgtagatcgtatcaaagctctttcataatcaattctttgtttaaac |
95 |
Q |
| |
|
|||| ||||||||||| ||||| ||||| ||| |||| |||||||||||||| ||||||||| ||| | | ||||||||||||||| |
|
|
| T |
15244911 |
agtggccaccaggttgccaggaagccataaaaagctatagctatgtagatcgtagcaaagctctgtcacagttgattctttgtttaaac |
15244999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 300
Target Start/End: Original strand, 17597475 - 17597521
Alignment:
| Q |
254 |
tctttttatgctttaacttggatagtgtatacttacacttagtcttt |
300 |
Q |
| |
|
||||||||| || ||||||||||| ||||||||| |||||||||||| |
|
|
| T |
17597475 |
tctttttatactataacttggataatgtatacttgcacttagtcttt |
17597521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 246 - 305
Target Start/End: Original strand, 3285485 - 3285544
Alignment:
| Q |
246 |
gatcgatatctttttatgctttaacttggatagtgtatacttacacttagtcttttcacc |
305 |
Q |
| |
|
||||||||||||||||| || ||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
3285485 |
gatcgatatctttttatactataacttggaaagtgtatacttgcacttagtctttccacc |
3285544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 246 - 300
Target Start/End: Original strand, 9274537 - 9274591
Alignment:
| Q |
246 |
gatcgatatctttttatgctttaacttggatagtgtatacttacacttagtcttt |
300 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
9274537 |
gatcgatatctttttatacttgaatttggatagtgtatacttgcacttagtcttt |
9274591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 250 - 300
Target Start/End: Original strand, 10180139 - 10180189
Alignment:
| Q |
250 |
gatatctttttatgctttaacttggatagtgtatacttacacttagtcttt |
300 |
Q |
| |
|
||||||||||||| || ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
10180139 |
gatatctttttatactataatttggatagtgtatacttgaacttagtcttt |
10180189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 308
Target Start/End: Complemental strand, 12109207 - 12109145
Alignment:
| Q |
246 |
gatcgatatctttttatgctttaacttggatagtgtatacttacacttagtcttttcaccctt |
308 |
Q |
| |
|
||||||||||||||||| | ||||||||| | ||||||||| |||||| ||||| ||||||| |
|
|
| T |
12109207 |
gatcgatatctttttatattataacttggacaatgtatacttgcacttaatctttccaccctt |
12109145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University