View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17161_high_4 (Length: 228)
Name: NF17161_high_4
Description: NF17161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17161_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 134
Target Start/End: Original strand, 3554433 - 3554549
Alignment:
| Q |
18 |
ataacacgttatgctccaaatgatttttctcttgatagaatttacactaattgcagcaatttgcgagtgatccagatgtgtagttttgttctaagagcac |
117 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3554433 |
ataacacattatgctccaaatgatttctctcttgatagaatttacactaattgcagcaatttgcgagtgatccagatgtgtagttttgttctaagagcac |
3554532 |
T |
|
| Q |
118 |
agggaccccttagtaca |
134 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
3554533 |
agggacaccttagtaca |
3554549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 167 - 212
Target Start/End: Original strand, 3554582 - 3554627
Alignment:
| Q |
167 |
gcagtcatgcgacattcatcataaactcaaccacccatctttctgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3554582 |
gcagtcatgcgacattcatcataaactcaaccacccatctttctgt |
3554627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 212
Target Start/End: Complemental strand, 3126729 - 3126684
Alignment:
| Q |
167 |
gcagtcatgcgacattcatcataaactcaaccacccatctttctgt |
212 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
3126729 |
gcagtcgtgcgacatgcatcataaactcaaccacccatttttctgt |
3126684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University