View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_high_19 (Length: 403)
Name: NF17162_high_19
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 269 - 372
Target Start/End: Complemental strand, 32986695 - 32986591
Alignment:
| Q |
269 |
ttgtttgattagattctgctaccaatctcattgatgctatgttgctttctac-ttttcaggtagttgacaccaatccaaccaaaggtatttttcctataa |
367 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||| |||||||||||||||||||| ||| |
|
|
| T |
32986695 |
ttgtttgatttgattctgctaccaatctcattgatgctatgttgctttgtactttttcaggtagttaacaccaatacaaccaaaggtatttttcctttaa |
32986596 |
T |
|
| Q |
368 |
tcaat |
372 |
Q |
| |
|
||||| |
|
|
| T |
32986595 |
tcaat |
32986591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University