View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_high_29 (Length: 353)
Name: NF17162_high_29
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 9 - 159
Target Start/End: Original strand, 28478680 - 28478827
Alignment:
| Q |
9 |
agtagcataggaggaagatgttgttgaagaagaagaacaacatttaaggaacaaaggttccaatttaacaccatagaaactagttgaaacagccattgta |
108 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28478680 |
agtaacataagaggaagatgttgttgaagaagaagaacaacatttaaggaacaaaggttccaatttagcaccatagaaactagttgaaacagccattgta |
28478779 |
T |
|
| Q |
109 |
attagtgtacttagacaataataatagtaatatgttacttggaactaaaac |
159 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28478780 |
attagtgtacttagac---aataatagtaatatgttacttggaactaaaac |
28478827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 216 - 338
Target Start/End: Original strand, 28478884 - 28479006
Alignment:
| Q |
216 |
aaatgaataatgaaatgatgtggcaaaagatgtggcgtatggaaagtatttggaattatttgataatgtgtgatttctttgtgttctgattggttggtga |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28478884 |
aaatgaataatgaaatgatgtggcaaaagatgtggcgtatggaaagtttttggaattatttgagaatgtgtgatttctttgtgttctgattggttggtga |
28478983 |
T |
|
| Q |
316 |
gtacacgttttatccacactcct |
338 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28478984 |
gtacacgttttatccacactcct |
28479006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University