View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_high_35 (Length: 311)
Name: NF17162_high_35
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_high_35 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 5 - 311
Target Start/End: Original strand, 32807789 - 32808097
Alignment:
| Q |
5 |
aaccacatagttgggtgaaaaattgacacgaacacatccaaattaaacttggttttttatgggcttcgaattgtgttgattcggattgcccttttctatt |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32807789 |
aaccgcatagttgggtgaaaaattgacacgaacacatccaaactaaacttggttttttatgggcttcgaattgtgttgattcggattgcccttttttatt |
32807888 |
T |
|
| Q |
105 |
gattggtttgattttgaatacccgtaattggcacgcaacaacgtcacatggataggctagaattccctatgtataaatgtcaaggccacaccaaaccaaa |
204 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32807889 |
gattggtttgattttgaatacccataattggcacgcaacaacgtcatatggataggctagaattccctatgtataaatgtgaaggccacaccaaaccaaa |
32807988 |
T |
|
| Q |
205 |
cacacacata-ctaacttactaa-nnnnnnnnnccgacaagggatggaaaccactagccaagaaactacacctcttcttcaagacatgaaggtgacaatc |
302 |
Q |
| |
|
|||||||||| ||||||| |||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32807989 |
cacacacatagctaacttgctaattttttttttccaacaagggatggaaaccactagccaagaaaggacacctcttcttcaagacatgaaggtgacaatc |
32808088 |
T |
|
| Q |
303 |
cacaaaact |
311 |
Q |
| |
|
||||||||| |
|
|
| T |
32808089 |
cacaaaact |
32808097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 243 - 311
Target Start/End: Original strand, 32824727 - 32824792
Alignment:
| Q |
243 |
gggatggaaaccactagccaagaaactacacctcttcttcaagacatgaaggtgacaatccacaaaact |
311 |
Q |
| |
|
||||||| |||||| | | ||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32824727 |
gggatgggaaccacaaacaaagaaactaaacctcttctt---gacatgaaggtgacaatccacaaaact |
32824792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University