View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_high_47 (Length: 253)
Name: NF17162_high_47
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 24 - 234
Target Start/End: Complemental strand, 50243970 - 50243760
Alignment:
| Q |
24 |
ataagaaccaatctataaaaagcagtggtgaaaaactgttttccatctcttccagacaccaatacaatacaaaacgttaacaaaaacacgcgaaagccat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243970 |
ataagaaccaatctataaaaagcagtggtgaaaaactgctttccatctcttccagacaccaatacaatacaaaacgttaacaaaaacacgcgaaagccat |
50243871 |
T |
|
| Q |
124 |
attcataactcttcattgcaggatatagcttcataaaacttgcacagaaccctgcaaatccccacaacaatacaatcatatactacatgtctggtgtctg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243870 |
attcataactcttcattgcaggatatagcttcataaaacttgcacagaaccctgcaaatccccacaacaatacaatcatatactacatgtctggtgtctg |
50243771 |
T |
|
| Q |
224 |
actcactgccc |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
50243770 |
actcactgccc |
50243760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University