View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_high_49 (Length: 251)
Name: NF17162_high_49
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_high_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 237
Target Start/End: Original strand, 4020578 - 4020799
Alignment:
| Q |
14 |
caaaggagggtttgattgagaggatctaaattatttggttggatttattgaatagggataatctgcactaagtggctaacccgcaaatccctcttctccg |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4020578 |
caaaagagggtttgattgagaggatctaaattatttggttggatttagtgaatagggataatctgcactaagtggctaacccgcaaatccctcttctccg |
4020677 |
T |
|
| Q |
114 |
tgtatagtgagtgtgaatttcaccactatgctctttgaaacnnnnnnnnnnngttgatgggtcaagtggctaaggtgtccaaattaaatcctagaagttg |
213 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4020678 |
tgtttagtgagtgtgaatttcaccactatgctctttgaaac--aaaaaaaaagttgatgggtcaagtggctaaggtgtccaaattaaatcctagaagttg |
4020775 |
T |
|
| Q |
214 |
atgtgttttaacactaaaatttat |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4020776 |
atgtgttttaacactaaaatttat |
4020799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University