View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_low_32 (Length: 342)
Name: NF17162_low_32
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 5 - 327
Target Start/End: Original strand, 47127746 - 47128072
Alignment:
| Q |
5 |
cgattgcagtattggatcgatcataactctaagacacctacctcacaagacgcagttgacggtattgtcaatctcattcatcctatatattttagtttga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47127746 |
cgattgcagtattggatcgatcataactctaagacacctacctcacaagatgcagttgacggtattgtcaatctcattcaccctatatattttagtttga |
47127845 |
T |
 |
| Q |
105 |
ttcaaatcttaatcactattacagtataggttccatcatatcgacnnnnnnnnctgaaaattaagacaatatttacctattttagttctgtctcactatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127846 |
ttcaaatcttaatcactattacagtataggttccatcatatcgacttttttt-ctgaaaattaagacaatatttacctattttagttctgtctcactatt |
47127944 |
T |
 |
| Q |
205 |
taaacataacttgtattttgtacttttacattgcacaataaaaaatcgtgat----ttcatgtgatttaatatttatctatttactttagatttatgttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127945 |
taaacataacttgtattttgtacttttacattgcacaataaaaaatcgtgatttcattcatgtgatttaatatttatctatttactttagatttatgttt |
47128044 |
T |
 |
| Q |
301 |
g-ttgtttaacatatttcttgtgcagtt |
327 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
47128045 |
gtttgtttaacatatttcttgtgcagtt |
47128072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University