View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_low_41 (Length: 296)
Name: NF17162_low_41
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 119 - 286
Target Start/End: Original strand, 53792421 - 53792588
Alignment:
| Q |
119 |
aatcagactcttttgtgtgtgcaaaaaacttggttgagaggggaggactctcagtgtgtgctcaacaaattctccaatagagatttgttgacaatggccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53792421 |
aatcagactcttttgtgtgtgcaaaaaacttggttgagaggggaggactctcagtgtgtgctcaacaaattccccaatagagatttgttgacaatggccc |
53792520 |
T |
|
| Q |
219 |
tgtttggttaaataacttcatttgccgcttataggataaaagcttatcgtgataagcacttagtataa |
286 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53792521 |
tgtttggttaaataacttcatttgcagcttataggataaaagcttatcgtgataagcacttagtataa |
53792588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 16 - 106
Target Start/End: Original strand, 53792283 - 53792373
Alignment:
| Q |
16 |
cacatcagagggtgcacctgatgtgaaaatatggttgcagacttacaaggtacatataaacagttaaatttaaatgattgtgtctctacac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53792283 |
cacatcagagggtgcacctgatgtgaaaatatggttgcagacttacaaggtacatataaacagttaaatttacatgattgtgtctctacac |
53792373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University