View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_low_55 (Length: 248)
Name: NF17162_low_55
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_low_55 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 27356975 - 27356735
Alignment:
| Q |
8 |
gataatactgggattcaatcgctttgtttgatggcacatccgcagccgaagcagtgtatcttcgagcatatttactttgctttgcctaattctgttgttt |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27356975 |
gataataatgggattcaatcgctttgtttgatggcacatccgcagccgaagcagtgtatcttcgagcatatttactttgctttgcctaattctgttgttt |
27356876 |
T |
 |
| Q |
108 |
ttggtaggtctgtgtatgaatcgcgtaggcgatttggtgaggtgcttgctactgagagtcctgttgattgtgatgttgtgatagctgttcctgattcggg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27356875 |
ttggtaggtctgtgtatgaatcgcgtaggcgatttggtgaggtgcttgctactgagagtcctgttgattgtgatgttgtgatagctgttcctgattctgg |
27356776 |
T |
 |
| Q |
208 |
tgttgtggctgctcttggttatgctgcgaaagctggcgttc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27356775 |
tgttgtggctgctcttggttatgctgcgaaagctggtgttc |
27356735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 162 - 248
Target Start/End: Complemental strand, 55060636 - 55060550
Alignment:
| Q |
162 |
agagtcctgttgattgtgatgttgtgatagctgttcctgattcgggtgttgtggctgctcttggttatgctgcgaaagctggcgttc |
248 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||| |||||||| ||||| |||||||||||||| |||||||| |||| |
|
|
| T |
55060636 |
agagtcctgttgattgtgatgttgttatagttgttcctgattttggtgttgttgctgcacttggttatgctgcaaaagctggtgttc |
55060550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University