View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_low_59 (Length: 238)
Name: NF17162_low_59
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_low_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 35269875 - 35269703
Alignment:
| Q |
1 |
tgtccactactttgattcagtttctgttcttgatttgtttgatcaatttctcttttgatctgcatctcagtttcacatgaacaaaattttctttccaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35269875 |
tgtccactactttgattcagtttctgttcttgatttgtttgatcaatttctcttttgatctgcatctcagtttcacatgaacaaaattttctttccaatt |
35269776 |
T |
 |
| Q |
101 |
tgtgtttccgtttgatcgcgtttcctttgttctcacatttttcccctaatttccagggttccgtgattttgtt |
173 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35269775 |
tgtgtttgcgtttgatcgcgtttcctttgttctcacatttttcccctaatttccagggttccgtgattttgtt |
35269703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 35268955 - 35268903
Alignment:
| Q |
169 |
ttgttgattgttaattggatatgatttgaatggttgcaatactcttggtaaga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35268955 |
ttgttgattgttaattggatatgatttgaatgcttgcaatactcttggtaaga |
35268903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 18704535 - 18704490
Alignment:
| Q |
176 |
ttgttaattggatatgatttgaatggttgcaatactcttggtaaga |
221 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
18704535 |
ttgttgattggatatgatttgaatgcttgcaatatgcttggtaaga |
18704490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 21 - 75
Target Start/End: Complemental strand, 7277584 - 7277530
Alignment:
| Q |
21 |
tttctgttcttgatttgtttgatcaatttctcttttgatctgcatctcagtttca |
75 |
Q |
| |
|
|||||||| |||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
7277584 |
tttctgttattgatttgttcgatcgatttctcttttgatctgcatctcaatttca |
7277530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University