View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_low_61 (Length: 235)
Name: NF17162_low_61
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_low_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 44603945 - 44604156
Alignment:
| Q |
18 |
aaatacttgtaaatatttatttttgacacatgtaatgaaactcaaaaacaaaaacatgtaatattattatgaatgaattttaataagctaatatttcgat |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44603945 |
aaatacttgtaaatatttaattttgacacatgtaatgaaactcaaaaacaaaaacatgtaatattattatgaatgaattttaataagctaatatttcgat |
44604044 |
T |
|
| Q |
118 |
atatcttaa----attaaatcaaaagtacataaattcaaattcattttaaggagagtgttgttttgttatatcatgtgggtagttcacgtacgtcgcaat |
213 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44604045 |
atatcttaaaattaataaatcaaaagtacataaattcaaattcattttaaggagagtgttgttttgttatgtcatgtgggtagttcacgtacgtcgcaat |
44604144 |
T |
|
| Q |
214 |
ttcacaggttct |
225 |
Q |
| |
|
||| |||||||| |
|
|
| T |
44604145 |
ttcccaggttct |
44604156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University