View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_low_68 (Length: 217)
Name: NF17162_low_68
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 22 - 200
Target Start/End: Original strand, 30173730 - 30173908
Alignment:
| Q |
22 |
atgcttgtgccggcaaccggtggtgagctgccggaaatgtttgcttacagaaatatgcgatcgattagtgaatcttggcttcaattccgcaatttgcaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30173730 |
atgcttgtgccggcaaccggtggtgagctgccggaaatgtttgcttacagaaatatgcgatcgattagtgaatcttggcttcaattccgcaatttgcaaa |
30173829 |
T |
|
| Q |
122 |
tctaaatggaaaagttcatccgagattccatcaggtatataaatatttacatgattcacttgttcttttacaagatatt |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30173830 |
tctaaatggaagagttcatccgagattccatcaggtatatacatatttacatgattcacttgttcttttacaagatatt |
30173908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 59 - 193
Target Start/End: Original strand, 12359999 - 12360133
Alignment:
| Q |
59 |
tgtttgcttacagaaatatgcgatcgattagtgaatcttggcttcaattccgcaatttgcaaatctaaatg-gaaaagttcatccgagattccatcaggt |
157 |
Q |
| |
|
|||||||| | ||||||||| |||| ||| ||||| | ||||||| ||||| ||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
12359999 |
tgtttgctcagagaaatatgtgatcaattgttgaatgt-ggcttcatttccggaatttgcaaatctaaattagggtagttcatccgagattccatcaggt |
12360097 |
T |
|
| Q |
158 |
atataaatatttacatgattcacttgttcttttaca |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12360098 |
atatacatatttacatgattcacttgttcttttaca |
12360133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University