View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17162_low_69 (Length: 211)
Name: NF17162_low_69
Description: NF17162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17162_low_69 |
 | |
|
| [»] scaffold0026 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 25802450 - 25802639
Alignment:
| Q |
1 |
acgtagttggagttatagatcgaactgtaagagttacaatttgcatgtggcttgtgtgagggaaatgctggtggaaaattggtacaacttatatatggga |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25802450 |
acgtagctggagttatagatcgaactgtaagagttacaatttgcatgtggcctgtgtgagggaaatgctggtggaaaattggtacaacttatatatggga |
25802549 |
T |
|
| Q |
101 |
catggtaaaggaagtagcaggaaacttgacgccactattcctagtttacagaatacattgtacgctgcacataattgcagaggaagtaga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25802550 |
catggtaaaggaagtagcaggaaacttgaggccactattcctagtttacagaatacattgtacgctgcacataattgcagaggaagtaga |
25802639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 31 - 115
Target Start/End: Original strand, 25816521 - 25816607
Alignment:
| Q |
31 |
gagttacaatttgcatgtggcttgtgtga--gggaaatgctggtggaaaattggtacaacttatatatgggacatggtaaaggaagt |
115 |
Q |
| |
|
|||||||||||||||||| |||||||| | |||||||| ||||||| |||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
25816521 |
gagttacaatttgcatgttgcttgtgttatagggaaatgttggtggagaattggctcaatttatatatggaacatggtaaaggaagt |
25816607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 108786 - 108620
Alignment:
| Q |
1 |
acgtagttggagttatagatcgaactgtaagagttacaatttgcatgtggcttgtgtgagggaaatgctggtggaaaattggtacaacttatatatggga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
108786 |
acgtagctggagttatagatcgaactgtaagagttacaatttacatgtggcttgtgtgagggaaatgctggtggaaaattggtacaacttatatatggga |
108687 |
T |
|
| Q |
101 |
catggtaaaggaagtagcaggaaacttgacgccactattcctagtttacagaatacattgtacgctg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
108686 |
catggtaaaggaagtagcaggaaacttgaggccattattcctagtttacagaatacattgtacgctg |
108620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 162 - 190
Target Start/End: Complemental strand, 105845 - 105817
Alignment:
| Q |
162 |
acgctgcacataattgcagaggaagtaga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
105845 |
acgctgcacataattgcagaggaagtaga |
105817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University