View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17163_low_4 (Length: 398)
Name: NF17163_low_4
Description: NF17163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17163_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 17 - 397
Target Start/End: Original strand, 13919417 - 13919797
Alignment:
| Q |
17 |
agttgtttgcatgggaaagttgggaagtcttgagttagcaagtggtgctttggccataggcttcaccaatgtaaccggatattcagtcctttcaggtcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919417 |
agttgtttgcatgggaaagttgggaagtcttgagttagcaagtggtgctttggccataggcttcaccaatgtaaccggatattcagtcctttcaggtcta |
13919516 |
T |
|
| Q |
117 |
gccatgggaatggagcctctatgtactcaagccattggttcacaaaacttctctttagtctctctcatattaagaagaacaattctcatgttattagtag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919517 |
gccatgggaatggagcctctatgtactcaagccattggttcacaaaacttctctttagtctctctcatattaagaagaacaattctcatgttattagtag |
13919616 |
T |
|
| Q |
217 |
cttcattacccatttcactcttgtggctaaatcttgaaccatttatgctatcccttcatcaaaatcaagatataacaagaatagcaagcctctattgccg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919617 |
cttcattacccatttcactcttgtggctaaatcttgaaccatttatgctatcccttcatcaaaatcaagatataacaagaatagcaagcctctattgccg |
13919716 |
T |
|
| Q |
317 |
cctctcgattcccgatcttatcgcgaatagcttccttcatccgattcgtatctatttacgtagcaaaggaacaacttggcc |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919717 |
cctctcgattcccgatcttatcgcgaatagcttccttcatccgattcgtatctatttacgtagcaaaggaacaacttggcc |
13919797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University