View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17163_low_6 (Length: 259)
Name: NF17163_low_6
Description: NF17163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17163_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 171235 - 170992
Alignment:
| Q |
18 |
atgccaaagggagaaatgagaacctttctatcattctagtcattgattgcacatcaaattttgaa--taaataattccattccccttgagattttagttt |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
171235 |
atgccaaaggaagaaatgagaacctttctatcattctagtcattgattgcacatcaaattttgaaaataaataattccattccccttgagattttagttt |
171136 |
T |
|
| Q |
116 |
cccatatcaatataaaagacaaattatcaccaaagcataccctactacactagcagcacaaggttttgctatttctgctgataatgcaagcatcagatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
171135 |
cccatatcaatataaaagacaaattatcaccaaagcataccctactacactagcagcacaacgttttgctatttctgcagataatgcaagcatcagatat |
171036 |
T |
|
| Q |
216 |
gacaaaatcgcatgggaatctatgatgataacaagaatcaaaga |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
171035 |
gacaaaatcgcatgggaatctatgatgataacaagaatcaaaga |
170992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University