View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17164_high_16 (Length: 243)
Name: NF17164_high_16
Description: NF17164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17164_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 46603628 - 46603419
Alignment:
| Q |
9 |
aacagagaatatatcatggtccaactctataccccactttgcaactgctcctctatcacgtataaatcataattcataactatcataccccaatccaaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46603628 |
aacagagaatatatcatggtccaactctataccccactttgcaactgctcctctatcacgtataaatcataattcataactatcataccccaatccaaaa |
46603529 |
T |
 |
| Q |
109 |
ctacattgatcacaagttaccattcctatccg---------catcattataatatacaatgatgatcgtctttaacgtgtgtcatgctgtgttgtgtcac |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
46603528 |
ctacattgatcacaagttaccattactatccgcatcttccgcatcattataatatacaatgatgattgtctttaacgtgtgtcatgctgtgttgtatcat |
46603429 |
T |
 |
| Q |
200 |
tttctattta |
209 |
Q |
| |
|
||| |||||| |
|
|
| T |
46603428 |
tttttattta |
46603419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University