View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17164_low_10 (Length: 298)
Name: NF17164_low_10
Description: NF17164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17164_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 277
Target Start/End: Complemental strand, 43960481 - 43960216
Alignment:
| Q |
13 |
aatatgccaacgggatacgtaaggaatttgtttggtatgggaagtgtttttattcatagtctctcaacgtcacaaggcaaaatcactgtcactataataa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43960481 |
aatatgccaacgggatacgtaaggaatttgtttggtatgggaagtgttcttattcatagtctctcaacgtcacaaggcaaaatcactgtcactataataa |
43960382 |
T |
|
| Q |
113 |
tgataaaataggagcgatcaatttatttacttgataaattactctcatcttcggtcaaaagaagaa-aaaacatttactctcacctcttaagatgccaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
43960381 |
tgataaaataggagcgatcaatttatttacttgataaattactctcatcttcggtcaaaagaagaaaaaaaaacttactctcacctcttaagatgccaat |
43960282 |
T |
|
| Q |
212 |
tttaaaatcaagnnnnnnnnactnnnnnnnncaattttcatatcatcaagctctatcttattgcct |
277 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43960281 |
tttaaaatcaagttttttttactaaaaaaaacaattttcatatcatcaagctctatcttattgcct |
43960216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University