View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17164_low_19 (Length: 219)
Name: NF17164_low_19
Description: NF17164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17164_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 25 - 201
Target Start/End: Complemental strand, 43960169 - 43959992
Alignment:
| Q |
25 |
gaaggatattgatcacgtatctgttatggagaaaagaaaacaaaa-tctcctttgcttcttatcacacttaagaatacgtgataagaaatttccagtaac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43960169 |
gaaggatattgatcacgtatctgttatggagaaaagaaaaaaaaaatctcctttgcttcttatcacacttaagaatacgtgataagaaatttccagtaac |
43960070 |
T |
 |
| Q |
124 |
agatatattcccagtaaatttcttaaaacccgctgtttccctttattttctgcttaatcgcagtcaacaagtagtaaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43960069 |
agatatattcccagtaaatttcttaaaacccactgtttccctttattttctttttaatcgcagtcaacaagtagtaaa |
43959992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University