View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17164_low_3 (Length: 440)
Name: NF17164_low_3
Description: NF17164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17164_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 391; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 7 - 433
Target Start/End: Complemental strand, 29048015 - 29047589
Alignment:
| Q |
7 |
tccaagaatatcatcatgtattgtgtccttgtctttgataacaacttcaagagtagttgcttgttgattctccttggcaaatgcaaacaccaggttccat |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048015 |
tccaacaaaatcatcatgtattgtgtccttgtctttgataacaacttcaagagtagttgcttgttgattctccttggcaaatgcaaacaccaggttccat |
29047916 |
T |
 |
| Q |
107 |
tcaggactattgtttttctcaaagtggttggtagttcctttgaagtttccaaccttgacaatcacatagggatcaaggctaccggtcaaatccatccttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29047915 |
tcaggactattgtttttctcaaagtgattggttgttcctttgaagtttccaaccttgacaatcacatagggatcaaggctaccggtcaaatccatccttg |
29047816 |
T |
 |
| Q |
207 |
gaagatcgcgagctttcacaactcgtacgaaaagatagtccattggttctacaaggtcataggtgctgctaggagatttattactcccccgaagaattct |
306 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
29047815 |
gaagatcgcgagctttcacaactcgtatgaaaagatagtccattggttctacaaggtcataggtgctgctaggagaattattactcccgcgaagaattct |
29047716 |
T |
 |
| Q |
307 |
tccaccaatgacttttccacctccaagagaaggacttgtctctttgattacatagtccattgcagacgctgctgtgcctgcaaacgctttaacaactttc |
406 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29047715 |
tccaccaacgacttttccacctccaagagaaggatttgtctctttgattacatagtccattgcagacgctgctgtgcctgcaaacgctttaacaactttc |
29047616 |
T |
 |
| Q |
407 |
ggagcagacggtccagatttcatctca |
433 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
29047615 |
ggagcagacggtccagatttcatctca |
29047589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University