View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17164_low_9 (Length: 301)
Name: NF17164_low_9
Description: NF17164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17164_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 283
Target Start/End: Original strand, 5460424 - 5460697
Alignment:
| Q |
11 |
caaaggagtgaacataaggaagaaaa-agaaggctttatatagctcttattatgctttgttaagtgacaaaatagagatttggtaactttatttcatctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5460424 |
caaaggagtgaacataaggaagaaaaaagaaggctttatatagctcttattatgctctgttaagtgacaaaatagagatttggtaactttatttcatctt |
5460523 |
T |
 |
| Q |
110 |
aattcggaggttatagtctcaaagatattcataatccttgagtaaataatctgtatgcctttaggcctaatcgatacctgttcaatcttcttgtcacaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5460524 |
aattcggaggttatagtctcaaagatattcataatccttgagtaaataatctgtatgcctttaggcctaatcgatacctgttcaatcttcttgtcacaac |
5460623 |
T |
 |
| Q |
210 |
ttacctgtctttactttatatatttctatatcatcttcgcattcctgataccatatcaaatatggtatgagaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5460624 |
ttacctgtctttactttatatatttctatatcatctttgcattcccgataccatatcaaatatggtatgagaaa |
5460697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University