View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17165_low_17 (Length: 235)
Name: NF17165_low_17
Description: NF17165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17165_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 38946052 - 38946216
Alignment:
| Q |
1 |
tcttgtgtttaacagtgattgttatctctacaaaaaagaatcgtcataatggtttgctaggttaataagaatgggttggaggtgggaagattggtcattg |
100 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38946052 |
tcttgtgtttaatagtggttgttatctctacaaaaagaagtcgtcataacggtttgctaggttaataagaatgggtttgaggtgggaagattggtcattg |
38946151 |
T |
 |
| Q |
101 |
ttgtaggaaagggtagagagtttgatggaaggtgatgattgagtttgatcgacgatgatgtgttat |
166 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||| || ||||||||||| |
|
|
| T |
38946152 |
ttgtaggaaagggaagagagtttgatggaaggtgatgattgagttt-atcgtcggtgatgtgttat |
38946216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 221
Target Start/End: Complemental strand, 38946354 - 38946296
Alignment:
| Q |
163 |
ttattcttatcaatcaattcatactttatatcatccttattgaatgttcatgttgttac |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38946354 |
ttattcttatcaatcaattcattctttatatcatccttattgaatgttcatgttgttac |
38946296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University