View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17165_low_8 (Length: 329)
Name: NF17165_low_8
Description: NF17165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17165_low_8 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 6e-65; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 204 - 329
Target Start/End: Complemental strand, 46455687 - 46455562
Alignment:
| Q |
204 |
ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactgaaggtgttggtttctcagttggaggatttgaaggagaattggattgagatggttt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455687 |
ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactgaaggtgttggtttctcagttggaggatttgaaggagaattggattgagatggttt |
46455588 |
T |
|
| Q |
304 |
actactacataatcccttggtgcaat |
329 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46455587 |
actactacataatcccttggtgcaat |
46455562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 46455890 - 46455756
Alignment:
| Q |
1 |
atgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtgatcgtgttcttcttttgggtgcttcattatgaggatca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455890 |
atgaactggtggtgaaggagaatgcacaggaggtggtgaggattgaactggtggcggcggtgatcgtgttcttcttttgggtgcttcattatgaggatca |
46455791 |
T |
|
| Q |
101 |
tcctcaattggtggttctgcttgaggtgtagaagg |
135 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
46455790 |
tcctcaattggtggttctgcttcaggtgtagaagg |
46455756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 63
Target Start/End: Complemental strand, 46456036 - 46455975
Alignment:
| Q |
2 |
tgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtga |
63 |
Q |
| |
|
||||| |||||||| |||||||| || || ||||||||||| ||||||||||| || ||||| |
|
|
| T |
46456036 |
tgaacaggtggtggtggagaatgaactggtggtggtggggagtgaactggtggaggaggtga |
46455975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University