View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_107 (Length: 239)
Name: NF17166_high_107
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_107 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 42640250 - 42640062
Alignment:
| Q |
1 |
ccatcgggatttgaacatcatgttcgcaacttgaatctttctggtgctcttgagcattttgaacatgggttgtaaccctccttggtggtggtcgtctatc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42640250 |
ccatcgagatttgaacatcatgttcgcaacttgaatctttctggtgctcttgagcattttgaacatgggttgtaaccctccttggtggtggtcgtctatc |
42640151 |
T |
 |
| Q |
101 |
aaatgcccttaagcactttgatttcttgtacactcggcataaactgaattcttgccttaactgcaaccaagaaaataatcaatatcaca |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42640150 |
aaatgcccttaagcactttgatttcttgtacactcggcataaactgaattcttgccttaactgcaaccaagaaaataatcaatatcaca |
42640062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University