View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_11 (Length: 582)
Name: NF17166_high_11
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 317; Significance: 1e-178; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 317; E-Value: 1e-178
Query Start/End: Original strand, 19 - 335
Target Start/End: Original strand, 43183729 - 43184045
Alignment:
| Q |
19 |
ccttgttattcattcctacgcacttctcccttgtcacagccgtcaccaccacctcctccggcgcggcaggttcgtttttgtccgcttcattggacatagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43183729 |
ccttgttattcattcctacgcacttctcccttgtcacagccgtcaccaccacctcctccggcgcggcaggttcgtttttgtccgcttcattggacatagc |
43183828 |
T |
|
| Q |
119 |
tatcaacggaggtgcaagaatcactcggttcaccgtgcacgttggaatttcgcctgaaccgctactgatagaggaaatgtcgccgttacggaaatcgtca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43183829 |
tatcaacggaggtgcaagaatcactcggttcaccgtgcacgttggaatttcgcctgaaccgctactgatagaggaaatgtcgccgttacggaaatcgtca |
43183928 |
T |
|
| Q |
219 |
gtgctgaaaacggaggaaatgcctgaagcggagctagttgaagtctgatcagagtcgactcgttcgagtttcgaatctgaatcgtccaaaggttccataa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43183929 |
gtgctgaaaacggaggaaatgcctgaagcggagctagttgaagtctgatcagagtcgactcgttcgagtttcgaatctgaatcgtccaaaggttccataa |
43184028 |
T |
|
| Q |
319 |
cggagcagtgattaagt |
335 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43184029 |
cggagcagtgattaagt |
43184045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 401 - 572
Target Start/End: Original strand, 43184111 - 43184283
Alignment:
| Q |
401 |
tcgacacgtgtgaggaaaattgttgcgagnnnnnnn-atggcacacgcatccattgtgaatttgtaattgatttgttgagcagggaatagaaacgaggca |
499 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184111 |
tcgacacgtgtgaagaaaattgttgcgagttttttttatggcacacgcatccattgtgaatttgtaattgatttgttgagcagggaatagaaacgaggca |
43184210 |
T |
|
| Q |
500 |
agtaattgtctgtactcgcactcacctgccttatgctgtgactccaccttttcaaacgtatctcttgcctatg |
572 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43184211 |
agtaattgtctgtactcgcactcacctgccttatgctgtgactccaccttttcaaacgtatctcttgcgtatg |
43184283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University