View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_110 (Length: 234)
Name: NF17166_high_110
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_110 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 37148033 - 37148233
Alignment:
| Q |
16 |
aaaattagttataagtaatttgaagggtcacttatataagaaaaaatcaaatctaaattcaacagtgactcataaaatttatcctttaaatgaatttagc |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37148033 |
aaaattagttgtaagtaatttgaagggtcacttatataagaaaaaatcaaatctaaattcaacagtgactcataaaatttatcctttaaatgaatttagc |
37148132 |
T |
 |
| Q |
116 |
tttgggcatgagcaattttgcatgaaattttacagccaatataattatagcactcaaacatactcaaagtaggtaatcatgtacaatgtgtgtgtatata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37148133 |
tttgggcatgagcaattttgcatgaaattttacagccagtataattatagcactcaaacatactcaaagtaggtaatcatgtacaatgtgtgtgtatata |
37148232 |
T |
 |
| Q |
216 |
c |
216 |
Q |
| |
|
| |
|
|
| T |
37148233 |
c |
37148233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University