View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_120 (Length: 214)
Name: NF17166_high_120
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_120 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 31478943 - 31479124
Alignment:
| Q |
16 |
aatatgtatgtagagtagcccataacatcatagtctattctagttggtttatagtctattcatagaaatgtcatacaaaaccatatgagtggcaaacaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31478943 |
aatatgtatgtagagtagcccataacatcatagtctattctagttggtttatagtctattcatagaaatgtcatacaaaaccatatgagtggcaaacaaa |
31479042 |
T |
 |
| Q |
116 |
accagcctaagctagataacccatt-nnnnnnngtcaaagtaattaagaaatgccatatgatagaaatgccacttatagata |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31479043 |
accagcctaagctagataacccattaaaaaaaagtcaaagtaattaagaaatgccatatgatagaaatgccacttatagata |
31479124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University