View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_123 (Length: 210)
Name: NF17166_high_123
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_123 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 84 - 195
Target Start/End: Complemental strand, 21437888 - 21437777
Alignment:
| Q |
84 |
gcaacaaagcctcaacaaaaaccacaccaccttcaacttcctctgacatagaacttcttttgttcaaaatcaaaccttcacttcaaggcaaaactgaaaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21437888 |
gcaacaaagcctcaacaaaaaccacaccaccttcaacttcctctgacatagaacttcttttgttcaaaatcaaaccttcacttcaaggcaaaactgagaa |
21437789 |
T |
 |
| Q |
184 |
ccttgttctctc |
195 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
21437788 |
ccttgtcctctc |
21437777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University